We use iLab for initiating requests and billing. Requests must be made through iLab before work begins. Please see the links below for instructions. Credit card payment is available for external customers.
Where to Drop Off/Send Your Samples
For UAMS customers
We are located in Biomed Building II, room 321-2. Samples may be dropped off in the core during business hours, or may be dropped off in our after-hours refrigerator in Biomed Building II, room 318-2 anytime.
For non-UAMS customers
Please ship your samples to the address shown below. We recommend the use of packing and seal your tubes with parafilm. Please ship your samples using the address shown below. It is highly suggested to use a shipping method with tracking.
Jennifer Johnson, DNA Sequencing Core Facility
Dept. of Microbiology and Immunology, Slot 511
Biomedical Building II, Room 321-2
4301 W. Markham
Little Rock, AR 72205
If you are off campus and do not have badge access to the building, but would like to drop your samples off with the core, please send an email to Jennifer Johnson (johnsonjennifer@uams.edu) to arrange a time to be met to collect the samples.
Pricing and Primers
$7.00 per Primer Reaction
Charging Policy:
We use commercially prepared plasmid as quality controls and compare sequence quality between customers to assess the overall success of a run. It is rare that we get poor quality results with the control. In the event of bad quality or failed sequences, we will repeat the reaction at no charge if the fault lays with the core. If the core suggests a sample be repeated, there will be no charge for the second reaction. If you request a repeat, but receive similar results, you will be charged for the second reaction. Repeats are performed with the original sample(s) submitted. Please contact us within 5 business days of data delivery to request any repeats.
Please pay invoices or IDTs immediately. Failure to do so may result in denial of future services.
We provide the following primers free of charge:
T7 Promotor: 5′ – gtaatacgactcactataggg – 3′
T7 Terminater: 5′ – gctagttattgctcagcgg – 3′
T3: 5′ – attacccctcactaaag – 3′
SP6: 5′ – tacgatttaggtgacactatag – 3′
M13fwd (-21): 5′ – tgtaaaacgacggccagt – 3′
M13rev: 5′ – ggaaacagctatgaccatg – 3′
Data Delivery
Results are usually delivered within two business days of submission. For faster turn around time, please submit your samples by 8:30am. If space is available, they will be added to that day’s run. Any submissions after 8:30am will be placed on the next day’s run.
You will receive your results by email which contains a ZIP file. Each ZIP file contains:
1. Chromatograms – the “peaks”. These files have the extension “.ab1” and can only be used with a chromatogram viewer.
2. Text Files – Simple text of the DNA sequence can be opened with any text editor such as Notepad or Wordpad.
Your files will be named with the following nomenclature:
WellPosition_yourtemplatename_primer.txt or .ab1