• Skip to main content
  • Skip to main content
Choose which site to search.
University of Arkansas for Medical Sciences Logo University of Arkansas for Medical Sciences
Department of Microbiology and Immunology: DNA Sequencing Core Facility
  • UAMS Health
  • Jobs
  • Giving
  • Preparing Your Samples for Submission (Sanger)
  • Submitting Samples (Sanger)
  • Recommendations, Downloads, and Useful Links (Sanger)
  • TapeStation 4150
  • NextSeq 2000 (Illumina)
  • Covaris ME220
  1. University of Arkansas for Medical Sciences
  2. College of Medicine
  3. Department of Microbiology and Immunology
  4. Research Cores
  5. DNA Sequencing Core Facility
  6. Submitting Samples (Sanger)

Submitting Samples (Sanger)

We use iLab for initiating requests and billing. Requests must be made through iLab before work begins. Please see the links below for instructions. Credit card payment is available for external customers.

  • UAMS Customers
  • External Customers

Where to Drop Off/Send Your Samples

For UAMS customers

We are located in Biomed Building II, room 321-2. Samples may be dropped off in the core during business hours, or may be dropped off in our after-hours refrigerator in Biomed Building II, room 318-2 anytime.

For non-UAMS customers

Please ship your samples to the address shown below. We recommend the use of packing and seal your tubes with parafilm. Please ship your samples using the address shown below. It is highly suggested to use a shipping method with tracking.

Dr. Simranjit Singh, DNA Sequencing Core Facility
Dept. of Microbiology and Immunology, Slot 511
Biomedical Building II, Room 321-2
4301 W. Markham
Little Rock, AR 72205

If you are off campus and do not have badge access to the building, but would like to drop your samples off with the core, please send an email to Dr. Simranjit Singh (ssingh@uams.edu) to arrange a time to be met to collect the samples.

Pricing and Primers

$7.00 per Primer Reaction
Charging Policy:
We use commercially prepared plasmid as quality controls and compare sequence quality between customers to assess the overall success of a run. It is rare that we get poor quality results with the control. In the event of bad quality or failed sequences, we will repeat the reaction at no charge if the fault lays with the core. If the core suggests a sample be repeated, there will be no charge for the second reaction. If you request a repeat, but receive similar results, you will be charged for the second reaction. Repeats are performed with the original sample(s) submitted. Please contact us within 5 business days of data delivery to request any repeats.
Please pay invoices or IDTs immediately. Failure to do so may result in denial of future services.

We provide the following primers free of charge:
T7 Promotor: 5′ – gtaatacgactcactataggg – 3′
T7 Terminater: 5′ – gctagttattgctcagcgg – 3′
T3: 5′ – attacccctcactaaag – 3′
SP6: 5′ – tacgatttaggtgacactatag – 3′
M13fwd (-21): 5′ – tgtaaaacgacggccagt – 3′
M13rev: 5′ – ggaaacagctatgaccatg – 3′

Data Delivery

Results are usually delivered within two business days of submission. For faster turn around time, please submit your samples by 8:30am. If space is available, they will be added to that day’s run. Any submissions after 8:30am will be placed on the next day’s run.
You will receive your results by email which contains a ZIP file. Each ZIP file contains:
1. Chromatograms – the “peaks”. These files have the extension “.ab1” and can only be used with a chromatogram viewer.
2. Text Files – Simple text of the DNA sequence can be opened with any text editor such as Notepad or Wordpad.
Your files will be named with the following nomenclature:
WellPosition_yourtemplatename_primer.txt or .ab1


UAMS College of Medicine LogoUAMS College of MedicineUniversity of Arkansas for Medical Sciences
Mailing Address: 4301 West Markham Street, Little Rock, AR 72205
Phone: (501) 686-7000
  • Facebook
  • X
  • Instagram
  • YouTube
  • LinkedIn
  • Pinterest
  • Disclaimer
  • Terms of Use
  • Privacy Statement
  • Legal Notices

© 2026 University of Arkansas for Medical Sciences